Transcript: Human NM_001077621.2

Homo sapiens VPS37D subunit of ESCRT-I (VPS37D), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
VPS37D (155382)
Length:
1618
CDS:
129..884

Additional Resources:

NCBI RefSeq record:
NM_001077621.2
NBCI Gene record:
VPS37D (155382)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077621.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246294 CATGTCCTGAGCCTACCTTTC pLKO_005 1296 3UTR 100% 6.000 8.400 N VPS37D n/a
2 TRCN0000257471 GGCTGCCCTGGCCATCAAATA pLKO_005 365 CDS 100% 4.400 3.080 N VPS37D n/a
3 TRCN0000246295 GACTGGAGGAAAGCATGCATC pLKO_005 433 CDS 100% 4.050 2.835 N VPS37D n/a
4 TRCN0000246296 ATACCAGGAGCTTCGTGAGGT pLKO_005 383 CDS 100% 2.640 1.848 N VPS37D n/a
5 TRCN0000257475 TGAGCTAGAAGAGGCGGAGCA pLKO_005 491 CDS 100% 0.720 0.504 N VPS37D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077621.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13299 pDONR223 100% 57.7% 57.7% None 1_318del n/a
2 ccsbBroad304_13299 pLX_304 0% 57.7% 57.7% V5 1_318del n/a
Download CSV