Transcript: Human NM_001080410.4

Homo sapiens F-box protein 41 (FBXO41), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
FBXO41 (150726)
Length:
7929
CDS:
1010..3637

Additional Resources:

NCBI RefSeq record:
NM_001080410.4
NBCI Gene record:
FBXO41 (150726)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080410.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239361 CAGATTGGGATTGCGGATTAT pLKO_005 3491 CDS 100% 13.200 9.240 N FBXO41 n/a
2 TRCN0000239359 TCCCATGGGTTTGGCTATTTC pLKO_005 5986 3UTR 100% 13.200 9.240 N FBXO41 n/a
3 TRCN0000239357 AGGAGAGCAAGGAGGAGTATG pLKO_005 2898 CDS 100% 10.800 7.560 N FBXO41 n/a
4 TRCN0000239358 CAAGGGTGCTGCTTGAGAATG pLKO_005 2778 CDS 100% 10.800 7.560 N FBXO41 n/a
5 TRCN0000239360 CCGGAACCTCAAGTCCATTGT pLKO_005 3466 CDS 100% 4.950 3.465 N FBXO41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080410.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.