Transcript: Human NM_001080429.3

Homo sapiens calmodulin regulated spectrin associated protein family member 3 (CAMSAP3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CAMSAP3 (57662)
Length:
4218
CDS:
141..3971

Additional Resources:

NCBI RefSeq record:
NM_001080429.3
NBCI Gene record:
CAMSAP3 (57662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080429.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283758 ATCGCATTCTGGAGGAAATTG pLKO_005 3652 CDS 100% 13.200 18.480 N CAMSAP3 n/a
2 TRCN0000268636 CGACGGATTGAGGCCATATTC pLKO_005 2076 CDS 100% 13.200 18.480 N CAMSAP3 n/a
3 TRCN0000268676 GCTGATGGACGACCTCGATAA pLKO_005 3188 CDS 100% 10.800 15.120 N CAMSAP3 n/a
4 TRCN0000268675 GGAGGACAGTCAGTCGGTATT pLKO_005 4026 3UTR 100% 10.800 7.560 N CAMSAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080429.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.