Transcript: Human NM_001080488.2

Homo sapiens one cut homeobox 3 (ONECUT3), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ONECUT3 (390874)
Length:
7185
CDS:
158..1642

Additional Resources:

NCBI RefSeq record:
NM_001080488.2
NBCI Gene record:
ONECUT3 (390874)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080488.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239377 ACGCTGATCGCCATCTTCAAG pLKO_005 1439 CDS 100% 4.950 6.930 N ONECUT3 n/a
2 TRCN0000239378 GGAGATCAACACCAAGGAGGT pLKO_005 1114 CDS 100% 2.160 1.512 N ONECUT3 n/a
3 TRCN0000239380 AGAAGCAGCGCCTGGTGTTCA pLKO_005 1401 CDS 100% 1.650 1.155 N ONECUT3 n/a
4 TRCN0000239381 AGCCGTGGAGCAAGCTCAAAT pLKO_005 1248 CDS 100% 13.200 7.920 N ONECUT3 n/a
5 TRCN0000239379 AGCCTGCAAGCGCAAGGAACA pLKO_005 1348 CDS 100% 1.350 0.810 N ONECUT3 n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4005 3UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 3995 3UTR 100% 13.200 6.600 Y IQCC n/a
8 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4002 3UTR 100% 4.950 2.475 Y LOC339059 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5064 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080488.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.