Transcript: Human NM_001080493.4

Homo sapiens zinc finger protein 823 (ZNF823), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ZNF823 (55552)
Length:
2396
CDS:
128..1960

Additional Resources:

NCBI RefSeq record:
NM_001080493.4
NBCI Gene record:
ZNF823 (55552)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080493.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244212 CTTGGGTCATTCGTCTCTTAA pLKO_005 448 CDS 100% 13.200 18.480 N ZNF823 n/a
2 TRCN0000244211 GTCCTAGTTCAGTTCGAAATC pLKO_005 1155 CDS 100% 10.800 15.120 N ZNF823 n/a
3 TRCN0000236722 GCCTTCAGCTGTTACTATTAC pLKO_005 977 CDS 100% 13.200 9.240 N ZNF823 n/a
4 TRCN0000236723 TGGTTCCAGCACCCTCTAAAT pLKO_005 2116 3UTR 100% 13.200 9.240 N ZNF823 n/a
5 TRCN0000236721 TTGGCCCAGTTTATTTCATTT pLKO_005 733 CDS 100% 13.200 7.920 N ZNF823 n/a
6 TRCN0000018221 CCTATCTAAGACATGAAAGAA pLKO.1 828 CDS 100% 5.625 2.813 Y ZNF443 n/a
7 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1877 CDS 100% 4.050 2.025 Y ZNF700 n/a
8 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1192 CDS 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080493.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.