Transcript: Human NM_001080533.3

Homo sapiens unc-119 lipid binding chaperone B (UNC119B), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
UNC119B (84747)
Length:
4381
CDS:
18..773

Additional Resources:

NCBI RefSeq record:
NM_001080533.3
NBCI Gene record:
UNC119B (84747)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080533.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254422 CCGGGTCACCGAGAATTATTT pLKO_005 248 CDS 100% 15.000 21.000 N UNC119B n/a
2 TRCN0000254423 ATGATCGAACGGCACTATTTC pLKO_005 531 CDS 100% 13.200 18.480 N UNC119B n/a
3 TRCN0000254421 GGAGGATGTCATTCGTCTAAT pLKO_005 650 CDS 100% 13.200 18.480 N UNC119B n/a
4 TRCN0000254420 TATCAGTTCACACCGGCATTT pLKO_005 441 CDS 100% 10.800 15.120 N UNC119B n/a
5 TRCN0000191061 CTTCTACTTTGTTGACAACAA pLKO.1 704 CDS 100% 4.950 3.960 N Unc119b n/a
6 TRCN0000265509 GTAGGTTGCAGAGGTACTATA pLKO_005 985 3UTR 100% 13.200 9.240 N UNC119B n/a
7 TRCN0000192925 GCTTCTACTTTGTTGACAACA pLKO.1 703 CDS 100% 4.950 3.465 N Unc119b n/a
8 TRCN0000243596 TGAAAGTAACAGAACCATTTA pLKO_005 3210 3UTR 100% 13.200 9.240 N LOC434513 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080533.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.