Transcript: Human NM_001080534.2

Homo sapiens unc-13 homolog C (UNC13C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
UNC13C (440279)
Length:
8396
CDS:
257..6901

Additional Resources:

NCBI RefSeq record:
NM_001080534.2
NBCI Gene record:
UNC13C (440279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254721 GACAAGACTCAGACCATTATT pLKO_005 3740 CDS 100% 15.000 10.500 N UNC13C n/a
2 TRCN0000254723 GAGCACCTTGCTGGCTAATAT pLKO_005 4579 CDS 100% 15.000 10.500 N UNC13C n/a
3 TRCN0000254719 GCCAAGACAATGCGCTATAAT pLKO_005 6169 CDS 100% 15.000 10.500 N UNC13C n/a
4 TRCN0000254720 TGTCTTGGCTTTACCATATTT pLKO_005 7628 3UTR 100% 15.000 10.500 N UNC13C n/a
5 TRCN0000254722 ATCATGGCATAGTCGATTAAG pLKO_005 2587 CDS 100% 13.200 9.240 N UNC13C n/a
6 TRCN0000028247 GCTCGAATAGTAAGTGGCAAT pLKO.1 3263 CDS 100% 4.050 2.835 N Unc13c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.