Transcript: Mouse NM_001080808.1

Mus musculus BICD family like cargo adaptor 1 (Bicdl1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Bicdl1 (75665)
Length:
1853
CDS:
1..1734

Additional Resources:

NCBI RefSeq record:
NM_001080808.1
NBCI Gene record:
Bicdl1 (75665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001080808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155599 CGAGATCAAGATGCTGTCAGA pLKO.1 768 CDS 100% 2.640 3.432 N BICDL1 n/a
2 TRCN0000251696 GCCTACTGCCAGGTTCGATAT pLKO_005 1120 CDS 100% 10.800 8.640 N Bicdl1 n/a
3 TRCN0000251697 TGAGAAGGCGATTCGAGAATC pLKO_005 464 CDS 100% 10.800 8.640 N Bicdl1 n/a
4 TRCN0000251698 ACGATCTCAAGAGGCTGATAC pLKO_005 1268 CDS 100% 10.800 7.560 N Bicdl1 n/a
5 TRCN0000265210 CGCCAAGTGCAAGATGGATAT pLKO_005 1473 CDS 100% 10.800 7.560 N Bicdl1 n/a
6 TRCN0000265205 TCCTCCACCAACCAGCATATC pLKO_005 724 CDS 100% 10.800 7.560 N Bicdl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.