Transcript: Human NM_001080975.2

Homo sapiens RALBP1 associated Eps domain containing 2 (REPS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
REPS2 (9185)
Length:
7975
CDS:
205..2184

Additional Resources:

NCBI RefSeq record:
NM_001080975.2
NBCI Gene record:
REPS2 (9185)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423057 GGTACGGATAGAGAGTATTAA pLKO_005 576 CDS 100% 15.000 21.000 N REPS2 n/a
2 TRCN0000428939 ATGATGGTGAGATACGATTTG pLKO_005 635 CDS 100% 10.800 15.120 N REPS2 n/a
3 TRCN0000056210 CCATTCCAGAACTCTCCTATA pLKO.1 1148 CDS 100% 10.800 7.560 N REPS2 n/a
4 TRCN0000056208 GCTACCAAGTCAGGATTGTTA pLKO.1 1717 CDS 100% 5.625 3.938 N REPS2 n/a
5 TRCN0000056212 CCCTGGAGGATAACAGAAGAA pLKO.1 1024 CDS 100% 4.950 3.465 N REPS2 n/a
6 TRCN0000201542 CGGATGGAGAAGACATCTGTT pLKO.1 1402 CDS 100% 4.950 3.465 N Reps2 n/a
7 TRCN0000056209 GCATGGAACTAAGGTTCAGAT pLKO.1 672 CDS 100% 4.950 3.465 N REPS2 n/a
8 TRCN0000056211 GAGGTTCATCAAGAACGAATT pLKO.1 2116 CDS 100% 0.000 0.000 N REPS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.