Transcript: Mouse NM_001081007.1

Mus musculus zinc finger protein 382 (Zfp382), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Zfp382 (233060)
Length:
2193
CDS:
87..1826

Additional Resources:

NCBI RefSeq record:
NM_001081007.1
NBCI Gene record:
Zfp382 (233060)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218995 CAGAGCAGAGGTTTGAATATA pLKO_005 796 CDS 100% 15.000 21.000 N Zfp382 n/a
2 TRCN0000218401 GCTGTAAATCGAACCTCATTA pLKO_005 1762 CDS 100% 13.200 18.480 N Zfp382 n/a
3 TRCN0000253392 GCCTCCTAAATCGATCGTAAT pLKO_005 467 CDS 100% 10.800 15.120 N Zfp382 n/a
4 TRCN0000253391 TTCATCAGTAGAGATATAAAC pLKO_005 618 CDS 100% 13.200 10.560 N Zfp382 n/a
5 TRCN0000253390 TCAAGCACAAGAAGCTAATTA pLKO_005 490 CDS 100% 15.000 10.500 N Zfp382 n/a
6 TRCN0000226247 GCCACCACAACTGGCAGATTT pLKO_005 1982 3UTR 100% 13.200 9.240 N Zfp382 n/a
7 TRCN0000218760 GGGAACTTCAACTACAGTAAA pLKO_005 885 CDS 100% 13.200 9.240 N Zfp382 n/a
8 TRCN0000253393 TATTCATCCACATGATCTTAT pLKO_005 941 CDS 100% 13.200 9.240 N Zfp382 n/a
9 TRCN0000226246 TAGAAGGAAGTCCTACCTTAT pLKO_005 1088 CDS 100% 10.800 7.560 N Zfp382 n/a
10 TRCN0000265385 TGGCCCAGAACTTGGTGCATA pLKO_005 1890 3UTR 100% 4.950 3.465 N Zfp382 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.