Transcript: Mouse NM_001081011.2

Mus musculus SLIT-ROBO Rho GTPase activating protein 2 (Srgap2), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Srgap2 (14270)
Length:
8040
CDS:
719..3934

Additional Resources:

NCBI RefSeq record:
NM_001081011.2
NBCI Gene record:
Srgap2 (14270)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081011.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271898 GAAAGTCCTGAACGAGCTTTA pLKO_005 1180 CDS 100% 10.800 15.120 N Srgap2 n/a
2 TRCN0000271899 TGATCGGGTTGCTGCGATATC pLKO_005 4200 3UTR 100% 10.800 15.120 N Srgap2 n/a
3 TRCN0000281902 CATCTGTCTTCAAGTACTATA pLKO_005 1503 CDS 100% 13.200 10.560 N Srgap2 n/a
4 TRCN0000271904 CATGACCTGTCTGATATTATT pLKO_005 1526 CDS 100% 15.000 10.500 N Srgap2 n/a
5 TRCN0000271903 TTGCCTTCCTCAATCACTTAT pLKO_005 2577 CDS 100% 13.200 7.920 N Srgap2 n/a
6 TRCN0000047959 GCATGGAGGATTACTGTGATA pLKO.1 2802 CDS 100% 4.950 3.465 N SRGAP2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 220 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081011.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.