Transcript: Mouse NM_001081021.1

Mus musculus zinc finger protein 780B (Zfp780b), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Zfp780b (338354)
Length:
5511
CDS:
183..2603

Additional Resources:

NCBI RefSeq record:
NM_001081021.1
NBCI Gene record:
Zfp780b (338354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238825 CACGGAACGAACCTTAGTATT pLKO_005 2490 CDS 100% 13.200 10.560 N Zfp780b n/a
2 TRCN0000238822 GTTATGGCAACAGAGTTATAA pLKO_005 3643 3UTR 100% 15.000 10.500 N Zfp780b n/a
3 TRCN0000238826 TCTCATTCAACATAGTGTTAT pLKO_005 2165 CDS 100% 13.200 9.240 N Zfp780b n/a
4 TRCN0000238824 TTGTTATGCACCAGACTATTC pLKO_005 1663 CDS 100% 10.800 7.560 N Zfp780b n/a
5 TRCN0000238823 GTACCAACTTAATGAACATTA pLKO_005 1823 CDS 100% 0.000 0.000 N Zfp780b n/a
6 TRCN0000218973 CTTACTCAGCATCAGAGTATT pLKO_005 738 CDS 100% 1.320 0.792 N Gm7452 n/a
7 TRCN0000234273 ATGCTACTCAGAAGGTCTTAT pLKO_005 277 CDS 100% 13.200 6.600 Y Gm7452 n/a
8 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 5315 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.