Transcript: Mouse NM_001081041.1

Mus musculus VPS51 GARP complex subunit (Vps51), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Vps51 (68505)
Length:
2631
CDS:
10..2358

Additional Resources:

NCBI RefSeq record:
NM_001081041.1
NBCI Gene record:
Vps51 (68505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156252 CGGGATGCTGAAGCTTTACTA pLKO.1 111 CDS 100% 5.625 7.875 N VPS51 n/a
2 TRCN0000269151 GGGTTCATGGATCCTTCTAAT pLKO_005 2443 3UTR 100% 13.200 9.240 N Vps51 n/a
3 TRCN0000269098 GGTGCTGACTGGCATCATTAA pLKO_005 2103 CDS 100% 13.200 9.240 N Vps51 n/a
4 TRCN0000269152 TCTCGCCTCTGCCTGGATTAT pLKO_005 1591 CDS 100% 13.200 9.240 N Vps51 n/a
5 TRCN0000347382 CACGGGATGCTGAAGCTTTAC pLKO_005 109 CDS 100% 10.800 7.560 N Vps51 n/a
6 TRCN0000363904 TGGAGGACACTACAGCTATTG pLKO_005 1859 CDS 100% 10.800 7.560 N Vps51 n/a
7 TRCN0000157603 GAACAGTTTCTGGTGCAGGAT pLKO.1 1651 CDS 100% 2.640 1.848 N VPS51 n/a
8 TRCN0000156899 GTGTTAGAGTTCACCGACCAT pLKO.1 907 CDS 100% 2.640 1.848 N VPS51 n/a
9 TRCN0000343672 GTGTTAGAGTTCACCGACCAT pLKO_005 907 CDS 100% 2.640 1.848 N VPS51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.