Transcript: Mouse NM_001081072.1

Mus musculus solute carrier family 27 (fatty acid transporter), member 6 (Slc27a6), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Slc27a6 (225579)
Length:
2598
CDS:
225..2084

Additional Resources:

NCBI RefSeq record:
NM_001081072.1
NBCI Gene record:
Slc27a6 (225579)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081072.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070374 CCCGTATTTCTGGGATGATTT pLKO.1 296 CDS 100% 13.200 18.480 N Slc27a6 n/a
2 TRCN0000070377 CCTCATTTCTCGTGTGAATAA pLKO.1 1493 CDS 100% 13.200 10.560 N Slc27a6 n/a
3 TRCN0000070376 CGTGTGTGCTAAAGAAGAAAT pLKO.1 1075 CDS 100% 13.200 9.240 N Slc27a6 n/a
4 TRCN0000070373 CCCGCTTTACTTTATGGATAA pLKO.1 1991 CDS 100% 10.800 7.560 N Slc27a6 n/a
5 TRCN0000070375 CCTCAAGTCTACTTGCCTCTA pLKO.1 866 CDS 100% 4.050 2.835 N Slc27a6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081072.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.