Transcript: Mouse NM_001081097.2

Mus musculus glutamate receptor, ionotropic, kainate 3 (Grik3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Grik3 (14807)
Length:
8860
CDS:
1..2760

Additional Resources:

NCBI RefSeq record:
NM_001081097.2
NBCI Gene record:
Grik3 (14807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081097.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251644 TAATGGATGCAAGCGTGAATA pLKO_005 4846 3UTR 100% 13.200 18.480 N Grik3 n/a
2 TRCN0000251646 CTCTGTCTACCCGCATCATTG pLKO_005 1895 CDS 100% 10.800 15.120 N Grik3 n/a
3 TRCN0000251647 GGCTCAATGGGAAGGATTAAC pLKO_005 1104 CDS 100% 13.200 9.240 N Grik3 n/a
4 TRCN0000425598 GGCTCAATGGGAAGGATTAAC pLKO_005 1104 CDS 100% 13.200 9.240 N GRIK3 n/a
5 TRCN0000251645 TCCGGATCGGAGGAATCTTTG pLKO_005 107 CDS 100% 10.800 6.480 N Grik3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6712 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081097.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.