Transcript: Mouse NM_001081109.1

Mus musculus lemur tyrosine kinase 2 (Lmtk2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Lmtk2 (231876)
Length:
8114
CDS:
239..4654

Additional Resources:

NCBI RefSeq record:
NM_001081109.1
NBCI Gene record:
Lmtk2 (231876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367993 AGTCATAGTGAAGGAGTTAAA pLKO_005 727 CDS 100% 13.200 18.480 N Lmtk2 n/a
2 TRCN0000196626 GACCCAGAAATAGACTTTAAG pLKO.1 446 CDS 100% 13.200 18.480 N LMTK2 n/a
3 TRCN0000023334 CCAGAATTAGTGACCAGCTTT pLKO.1 1166 CDS 100% 4.950 6.930 N Lmtk2 n/a
4 TRCN0000023337 CGACCTTCAAACAGAACTCAA pLKO.1 2410 CDS 100% 4.950 6.930 N Lmtk2 n/a
5 TRCN0000367997 TATTGTACAGCATCGTAAATT pLKO_005 5092 3UTR 100% 15.000 10.500 N Lmtk2 n/a
6 TRCN0000023335 CCCATCCTTGTGAATGATATT pLKO.1 2849 CDS 100% 13.200 9.240 N Lmtk2 n/a
7 TRCN0000360933 TTCGATGATGTCACCGTTTAT pLKO_005 4220 CDS 100% 13.200 9.240 N Lmtk2 n/a
8 TRCN0000023338 CCTGTCTTACTCCAGCATGTT pLKO.1 1726 CDS 100% 4.950 3.465 N Lmtk2 n/a
9 TRCN0000023336 CCCATCATTGTCAGTAACGAT pLKO.1 4100 CDS 100% 3.000 2.100 N Lmtk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.