Transcript: Mouse NM_001081142.1

Mus musculus potassium voltage-gated channel, subfamily Q, member 4 (Kcnq4), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Kcnq4 (60613)
Length:
2512
CDS:
1..2091

Additional Resources:

NCBI RefSeq record:
NM_001081142.1
NBCI Gene record:
Kcnq4 (60613)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068691 GCAGTCCATCGAACATAAGTT pLKO.1 1881 CDS 100% 5.625 7.875 N Kcnq4 n/a
2 TRCN0000068689 CCGTTCTGTCAGGATTCTGAA pLKO.1 1605 CDS 100% 4.950 6.930 N Kcnq4 n/a
3 TRCN0000444479 AGGAACTTGCCAACGAGTGTC pLKO_005 377 CDS 100% 4.050 5.670 N KCNQ4 n/a
4 TRCN0000068690 GTGTCTCCTTATCTTGGAATT pLKO.1 393 CDS 100% 0.000 0.000 N Kcnq4 n/a
5 TRCN0000044946 GTCTACCACGTCTTCATATTT pLKO.1 301 CDS 100% 15.000 10.500 N KCNQ4 n/a
6 TRCN0000068688 GCCCTCTTGTTTGAGCACATA pLKO.1 1141 CDS 100% 4.950 3.465 N Kcnq4 n/a
7 TRCN0000068692 GATGGGCATCAAAGACCGAAT pLKO.1 1302 CDS 100% 4.050 2.835 N Kcnq4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.