Transcript: Mouse NM_001081148.1

Mus musculus cytochrome P450, family 2, subfamily b, polypeptide 23 (Cyp2b23), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Cyp2b23 (243881)
Length:
2182
CDS:
1..1476

Additional Resources:

NCBI RefSeq record:
NM_001081148.1
NBCI Gene record:
Cyp2b23 (243881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265368 CTGGCACTCACAGACAAATTT pLKO_005 683 CDS 100% 15.000 12.000 N Cyp2b23 n/a
2 TRCN0000265359 ATTGCAGTGATTCAGCCAATT pLKO_005 301 CDS 100% 10.800 8.640 N Cyp2b23 n/a
3 TRCN0000253224 TTGTCACTTATCAGCTCATTC pLKO_005 616 CDS 100% 10.800 8.640 N Cyp2b23 n/a
4 TRCN0000253226 ACCTACTGATGCTTCTCTAAA pLKO_005 1585 3UTR 100% 13.200 9.240 N Cyp2b23 n/a
5 TRCN0000253225 TGTATCGGATCTGCTTCTTAC pLKO_005 1448 CDS 100% 10.800 7.560 N Cyp2b23 n/a
6 TRCN0000193231 CATCCATGAGATTCAGAGATT pLKO.1 1056 CDS 100% 4.950 2.475 Y Cyp2b9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.