Transcript: Mouse NM_001081149.1

Mus musculus K(lysine) acetyltransferase 6A (Kat6a), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Kat6a (244349)
Length:
9126
CDS:
495..6506

Additional Resources:

NCBI RefSeq record:
NM_001081149.1
NBCI Gene record:
Kat6a (244349)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081149.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271937 ATTATCCAACACGGTAATATT pLKO_005 8575 3UTR 100% 15.000 21.000 N Kat6a n/a
2 TRCN0000077152 GCAGTGACCAATTTGTGATTA pLKO.1 2710 CDS 100% 13.200 18.480 N Kat6a n/a
3 TRCN0000284572 GCGTCAAAGACGGGACGATTT pLKO_005 655 CDS 100% 10.800 15.120 N Kat6a n/a
4 TRCN0000077150 GCAAGCGGAAACACCACAATA pLKO.1 3565 CDS 100% 13.200 10.560 N Kat6a n/a
5 TRCN0000077149 GCACATTTCTATCCGTTCCAA pLKO.1 6050 CDS 100% 3.000 2.400 N Kat6a n/a
6 TRCN0000271896 ATGCCCACTCCAGCCTATAAT pLKO_005 6201 CDS 100% 15.000 10.500 N Kat6a n/a
7 TRCN0000271933 GTACTCAAGGCTGCCTAAATT pLKO_005 2081 CDS 100% 15.000 10.500 N Kat6a n/a
8 TRCN0000281843 CCACGACTGGAGCCTACATTT pLKO_005 3669 CDS 100% 13.200 9.240 N Kat6a n/a
9 TRCN0000077148 GCGGTCATCCATCGTGTTTAA pLKO.1 1201 CDS 100% 13.200 9.240 N Kat6a n/a
10 TRCN0000077151 CCCTTGAAGTTCAACAAGAAA pLKO.1 1686 CDS 100% 5.625 3.938 N Kat6a n/a
11 TRCN0000013126 CCAGTGTTTCTCTGTCCAATA pLKO.1 5836 CDS 100% 10.800 7.560 N KAT6A n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7151 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081149.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.