Transcript: Mouse NM_001081153.2

Mus musculus unc-13 homolog C (Unc13c), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Unc13c (208898)
Length:
8867
CDS:
787..7419

Additional Resources:

NCBI RefSeq record:
NM_001081153.2
NBCI Gene record:
Unc13c (208898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028216 CCACGATTACATTAAACACTT pLKO.1 1692 CDS 100% 4.950 6.930 N Unc13c n/a
2 TRCN0000028247 GCTCGAATAGTAAGTGGCAAT pLKO.1 3781 CDS 100% 4.050 5.670 N Unc13c n/a
3 TRCN0000027757 GCTCAGCTTAACCAGAGCTTT pLKO.1 5986 CDS 100% 4.950 3.960 N LOC235480 n/a
4 TRCN0000027685 GCCCGAGAAGATCGAATAATT pLKO.1 7201 CDS 100% 15.000 10.500 N LOC235480 n/a
5 TRCN0000027758 GCTCTGGAAATTAGTACTTAA pLKO.1 6528 CDS 100% 13.200 9.240 N LOC235480 n/a
6 TRCN0000028236 CCCATCCTAGTGTACTTTGAA pLKO.1 1903 CDS 100% 5.625 3.938 N Unc13c n/a
7 TRCN0000027720 CTAAAGAGTTTGTGAGACTTA pLKO.1 7364 CDS 100% 4.950 3.465 N LOC235480 n/a
8 TRCN0000028262 GCCAATTCTAATGACCTGTAT pLKO.1 3004 CDS 100% 4.950 3.465 N Unc13c n/a
9 TRCN0000027762 GCCTTGCATATTGATGAACAA pLKO.1 6153 CDS 100% 4.950 3.465 N LOC235480 n/a
10 TRCN0000028215 CCAGACTATCATCACAGCCAT pLKO.1 4266 CDS 100% 2.640 1.848 N Unc13c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.