Transcript: Mouse NM_001081161.1

Mus musculus family with sequence similarity 171, member A1 (Fam171a1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Fam171a1 (269233)
Length:
4146
CDS:
169..2847

Additional Resources:

NCBI RefSeq record:
NM_001081161.1
NBCI Gene record:
Fam171a1 (269233)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081161.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238532 CTCGACGAGCATCAGATTATC pLKO_005 1268 CDS 100% 13.200 18.480 N Fam171a1 n/a
2 TRCN0000238530 CCACGTATCACACGGTGTTTC pLKO_005 1064 CDS 100% 10.800 15.120 N Fam171a1 n/a
3 TRCN0000238531 TGACATGGGAATTACGGTTAT pLKO_005 2970 3UTR 100% 10.800 15.120 N Fam171a1 n/a
4 TRCN0000238528 TATGAAGATGTCGTCCAAATA pLKO_005 550 CDS 100% 13.200 10.560 N Fam171a1 n/a
5 TRCN0000264229 TATGAAGATGTCGTCCAAATA pLKO_005 550 CDS 100% 13.200 10.560 N FAM171A1 n/a
6 TRCN0000168035 CGGAAGTAATGATGCCAGTTT pLKO.1 2367 CDS 100% 4.950 3.960 N FAM171A1 n/a
7 TRCN0000238529 GCTGGAAGGAACGGAAGTAAT pLKO_005 2356 CDS 100% 13.200 9.240 N Fam171a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081161.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.