Transcript: Mouse NM_001081282.2

Mus musculus inhibitor of Bruton agammaglobulinemia tyrosine kinase (Ibtk), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ibtk (108837)
Length:
5679
CDS:
569..4627

Additional Resources:

NCBI RefSeq record:
NM_001081282.2
NBCI Gene record:
Ibtk (108837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088505 GCTTCTCATAACTCGGTTAAA pLKO.1 3130 CDS 100% 13.200 18.480 N Ibtk n/a
2 TRCN0000332158 GCTTCTCATAACTCGGTTAAA pLKO_005 3130 CDS 100% 13.200 18.480 N Ibtk n/a
3 TRCN0000088507 CTCGGAAACTATGTTCAAGAA pLKO.1 3481 CDS 100% 4.950 6.930 N Ibtk n/a
4 TRCN0000354127 CTCGGAAACTATGTTCAAGAA pLKO_005 3481 CDS 100% 4.950 6.930 N Ibtk n/a
5 TRCN0000088503 GCCGCATAAGATGTTATGTTA pLKO.1 4983 3UTR 100% 0.563 0.788 N Ibtk n/a
6 TRCN0000332287 GCCGCATAAGATGTTATGTTA pLKO_005 4983 3UTR 100% 0.563 0.788 N Ibtk n/a
7 TRCN0000088506 CCTGATACAAATAGTGTGTAT pLKO.1 2045 CDS 100% 0.495 0.693 N Ibtk n/a
8 TRCN0000088504 GCATGGTGTTAGCTTGTATAT pLKO.1 889 CDS 100% 13.200 9.240 N Ibtk n/a
9 TRCN0000332226 GCATGGTGTTAGCTTGTATAT pLKO_005 889 CDS 100% 13.200 9.240 N Ibtk n/a
10 TRCN0000082575 GCTGTTAGTGTCAGCACAGAT pLKO.1 2105 CDS 100% 4.950 3.465 N IBTK n/a
11 TRCN0000333740 GCTGTTAGTGTCAGCACAGAT pLKO_005 2105 CDS 100% 4.950 3.465 N IBTK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.