Transcript: Mouse NM_001081285.1

Mus musculus major urinary protein 6 (Mup6), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Mup6 (620807)
Length:
540
CDS:
1..540

Additional Resources:

NCBI RefSeq record:
NM_001081285.1
NBCI Gene record:
Mup6 (620807)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270922 ATGAAGAGTGCTCCGAAATAT pLKO_005 233 CDS 100% 15.000 9.000 N Mup6 n/a
2 TRCN0000270942 GATAGAAGAACATGGCATCAT pLKO_005 144 CDS 100% 4.950 2.970 N Mup6 n/a
3 TRCN0000270943 TCTATGGGAAGGAACTTTAAT pLKO_005 64 CDS 100% 15.000 7.500 Y Mup6 n/a
4 TRCN0000270940 ACTTAAGACAGACTATGATAA pLKO_005 327 CDS 100% 13.200 6.600 Y Mup6 n/a
5 TRCN0000284694 CTATGGCCGAGAACCAGATTT pLKO_005 408 CDS 100% 13.200 6.600 Y Mup7 n/a
6 TRCN0000270866 GGTGAATATTCTGTGACATAT pLKO_005 283 CDS 100% 13.200 6.600 Y Mup6 n/a
7 TRCN0000272268 TATGGCCGAGAACCAGATTTG pLKO_005 409 CDS 100% 10.800 5.400 Y Mup8 n/a
8 TRCN0000272250 CCATGCAGAAGAAGCTAGTTC pLKO_005 45 CDS 100% 4.950 2.475 Y Mup9 n/a
9 TRCN0000105463 TCCATGCAGAAGAAGCTAGTT pLKO.1 44 CDS 100% 4.950 2.475 Y Mup2 n/a
10 TRCN0000105479 GAGGAGCATGGAATCATTAAA pLKO.1 466 CDS 100% 15.000 7.500 Y Mup4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.