Transcript: Mouse NM_001081298.1

Mus musculus adhesion G protein-coupled receptor L2 (Adgrl2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Adgrl2 (99633)
Length:
6052
CDS:
1..4464

Additional Resources:

NCBI RefSeq record:
NM_001081298.1
NBCI Gene record:
Adgrl2 (99633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238691 TACCGCACCGATACGTTAATA pLKO_005 544 CDS 100% 0.000 0.000 N Adgrl2 n/a
2 TRCN0000238693 AGCTATCCTGTGAGGGTTATT pLKO_005 116 CDS 100% 13.200 10.560 N Adgrl2 n/a
3 TRCN0000238694 GAACGGCTTATGGGTCATTTA pLKO_005 822 CDS 100% 13.200 10.560 N Adgrl2 n/a
4 TRCN0000238695 CCCAACCAGTACCAGTATATT pLKO_005 1087 CDS 100% 15.000 10.500 N Adgrl2 n/a
5 TRCN0000238692 CTAGGGCCACATGCAAGTATT pLKO_005 4484 3UTR 100% 13.200 9.240 N Adgrl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.