Transcript: Mouse NM_001081310.2

Mus musculus transmembrane protein 236 (Tmem236), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tmem236 (625286)
Length:
3658
CDS:
67..1101

Additional Resources:

NCBI RefSeq record:
NM_001081310.2
NBCI Gene record:
Tmem236 (625286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269574 ATAAACGTCTGTGGTATATAA pLKO_005 1174 3UTR 100% 15.000 21.000 N Tmem236 n/a
2 TRCN0000269577 CCCTGATTGTGGTTGACATTA pLKO_005 470 CDS 100% 13.200 18.480 N Tmem236 n/a
3 TRCN0000269575 TAACCTCGTTGCAACAGATAA pLKO_005 557 CDS 100% 13.200 18.480 N Tmem236 n/a
4 TRCN0000269511 TATCAATGGCTCAGCTAATTC pLKO_005 402 CDS 100% 13.200 18.480 N Tmem236 n/a
5 TRCN0000269576 GTAGTTCAGAGTGACGGAAAT pLKO_005 595 CDS 100% 10.800 15.120 N Tmem236 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1231 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.