Transcript: Mouse NM_001081325.2

Mus musculus sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 6 (Sult2a6), mRNA.

Source:
NCBI, updated 2013-04-18
Taxon:
Mus musculus (mouse)
Gene:
Sult2a6 (629219)
Length:
969
CDS:
38..895

Additional Resources:

NCBI RefSeq record:
NM_001081325.2
NBCI Gene record:
Sult2a6 (629219)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270796 TGTTCTAGTGTCTGGTTATTT pLKO_005 412 CDS 100% 15.000 12.000 N Sult2a6 n/a
2 TRCN0000270797 ATTGTGGAAGATGTCCATAAT pLKO_005 101 CDS 100% 13.200 9.240 N Sult2a6 n/a
3 TRCN0000270724 GATGAAGACTTGATCATATTG pLKO_005 137 CDS 100% 13.200 9.240 N Sult2a6 n/a
4 TRCN0000270795 CCAAAGCTAAGGTGATCTATC pLKO_005 372 CDS 100% 10.800 7.560 N Sult2a6 n/a
5 TRCN0000270726 TAGAGTCACTAGGAATTTATT pLKO_005 465 CDS 100% 15.000 9.000 N Sult2a6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.