Transcript: Mouse NM_001081477.1

Mus musculus bromodomain and WD repeat domain containing 3 (Brwd3), mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Brwd3 (382236)
Length:
6434
CDS:
227..5626

Additional Resources:

NCBI RefSeq record:
NM_001081477.1
NBCI Gene record:
Brwd3 (382236)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226213 AGTCGACTTCCACGGATTAAA pLKO_005 5441 CDS 100% 15.000 21.000 N Brwd3 n/a
2 TRCN0000218950 GATGTCCTACTTCGGTTTATT pLKO_005 3926 CDS 100% 15.000 21.000 N Brwd3 n/a
3 TRCN0000252329 GATTCCTATGCCCAGTAATAA pLKO_005 6102 3UTR 100% 15.000 21.000 N Brwd3 n/a
4 TRCN0000226212 TGATAGATTCCGCAGTATAAT pLKO_005 3373 CDS 100% 15.000 21.000 N Brwd3 n/a
5 TRCN0000359014 TGATAGATTCCGCAGTATAAT pLKO_005 3373 CDS 100% 15.000 21.000 N BRWD3 n/a
6 TRCN0000226211 ATCGAAGCGGGAGGCGAATTT pLKO_005 792 CDS 100% 13.200 18.480 N Brwd3 n/a
7 TRCN0000252330 CCAGATAGTCCCATAGTTAAA pLKO_005 3887 CDS 100% 13.200 18.480 N Brwd3 n/a
8 TRCN0000226214 TAAGAACGATCTGGATTATTT pLKO_005 6185 3UTR 100% 15.000 10.500 N Brwd3 n/a
9 TRCN0000252333 AGCCAAATCATTTCGTAATAG pLKO_005 4831 CDS 100% 13.200 9.240 N Brwd3 n/a
10 TRCN0000252331 GATCATGTAATTAGGATATAC pLKO_005 1241 CDS 100% 13.200 9.240 N Brwd3 n/a
11 TRCN0000252332 TGAGGAGTGTGAACGAGTTAT pLKO_005 3652 CDS 100% 13.200 9.240 N Brwd3 n/a
12 TRCN0000136866 CCCAGGGAAAGCCAAATCATT pLKO.1 4822 CDS 100% 5.625 3.938 N BRWD3 n/a
13 TRCN0000159686 GCCAGTATACATTTGTTTCAA pLKO.1 5759 3UTR 100% 5.625 3.938 N BRWD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.