Transcript: Mouse NM_001081499.2

Mus musculus TBC1 domain family, member 8B (Tbc1d8b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d8b (245638)
Length:
5907
CDS:
186..3530

Additional Resources:

NCBI RefSeq record:
NM_001081499.2
NBCI Gene record:
Tbc1d8b (245638)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254349 ATAGCATGCGCTGTCGAAATA pLKO_005 2467 CDS 100% 13.200 18.480 N Tbc1d8b n/a
2 TRCN0000254346 TGAAGCGGTGACGGCACTAAA pLKO_005 2282 CDS 100% 13.200 18.480 N Tbc1d8b n/a
3 TRCN0000055719 CGCTGTCGAAATAGGTTGTAT pLKO.1 2475 CDS 100% 5.625 7.875 N TBC1D8B n/a
4 TRCN0000254348 TACTTACTAGGGTACTATATA pLKO_005 4472 3UTR 100% 15.000 10.500 N Tbc1d8b n/a
5 TRCN0000254347 TCAAGGAGAGAATCACTATTT pLKO_005 857 CDS 100% 13.200 9.240 N Tbc1d8b n/a
6 TRCN0000254345 TCATACTAAAGTGGATATTAC pLKO_005 2390 CDS 100% 13.200 9.240 N Tbc1d8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.