Transcript: Mouse NM_001081557.3

Mus musculus calmodulin binding transcription activator 1 (Camta1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Camta1 (100072)
Length:
8448
CDS:
100..5148

Additional Resources:

NCBI RefSeq record:
NM_001081557.3
NBCI Gene record:
Camta1 (100072)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231369 GAAACAGCTTACGGGATTTAA pLKO_005 5888 3UTR 100% 15.000 21.000 N Camta1 n/a
2 TRCN0000231367 CCCGACTGTTTCCTCAATAAT pLKO_005 1552 CDS 100% 15.000 12.000 N Camta1 n/a
3 TRCN0000231368 TCGGTCTGAACCCTCTAATTA pLKO_005 3777 CDS 100% 15.000 12.000 N Camta1 n/a
4 TRCN0000231365 TGAGGAAATTGCGGCTTATTT pLKO_005 330 CDS 100% 15.000 10.500 N Camta1 n/a
5 TRCN0000231366 CCATGTTCCATGGTATCAAAT pLKO_005 758 CDS 100% 13.200 9.240 N Camta1 n/a
6 TRCN0000150628 GCCAAGTAATGTGAATGCTAA pLKO.1 6684 3UTR 100% 4.950 3.465 N CAMTA1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5257 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.