Transcript: Mouse NM_001081656.2

Mus musculus neuralized E3 ubiquitin protein ligase 1B (Neurl1b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Neurl1b (240055)
Length:
6195
CDS:
1..1641

Additional Resources:

NCBI RefSeq record:
NM_001081656.2
NBCI Gene record:
Neurl1b (240055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176675 CCCTAACAGAACTATCCATAT pLKO.1 5720 3UTR 100% 10.800 7.560 N Neurl1b n/a
2 TRCN0000198213 CCCTATACATAGCAGCCATAT pLKO.1 4845 3UTR 100% 10.800 7.560 N Neurl1b n/a
3 TRCN0000200382 GCTCTCAGGCAAGAGATCATA pLKO.1 5065 3UTR 100% 5.625 3.938 N Neurl1b n/a
4 TRCN0000178509 CACTTGTTCAGCATCCACTTA pLKO.1 4980 3UTR 100% 4.950 3.465 N Neurl1b n/a
5 TRCN0000200170 CATGGCTCATGGTCAGAACAT pLKO.1 5005 3UTR 100% 4.950 3.465 N Neurl1b n/a
6 TRCN0000182687 GAGGTTGAAGACTGGGACAAA pLKO.1 5026 3UTR 100% 4.950 3.465 N Neurl1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.