Transcript: Mouse NM_001081695.2

Mus musculus DNA (cytosine-5-)-methyltransferase 3-like (Dnmt3l), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Dnmt3l (54427)
Length:
1831
CDS:
284..1549

Additional Resources:

NCBI RefSeq record:
NM_001081695.2
NBCI Gene record:
Dnmt3l (54427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362894 CGGCCCTTCTTCTGGATATTC pLKO_005 1223 CDS 100% 13.200 10.560 N Dnmt3l n/a
2 TRCN0000039108 GTACTAAAGAGTTTGGGCTTT pLKO.1 989 CDS 100% 4.050 3.240 N Dnmt3l n/a
3 TRCN0000362891 GGACCTCAGAGAGGATCAATG pLKO_005 771 CDS 100% 10.800 7.560 N Dnmt3l n/a
4 TRCN0000362822 TGATCAGGTACGAAGTCAAAG pLKO_005 495 CDS 100% 10.800 7.560 N Dnmt3l n/a
5 TRCN0000362823 TGTACCAGATGCTACTGTTTC pLKO_005 722 CDS 100% 10.800 7.560 N Dnmt3l n/a
6 TRCN0000039104 CTGTACCAGATGCTACTGTTT pLKO.1 721 CDS 100% 4.950 3.465 N Dnmt3l n/a
7 TRCN0000039107 CCCTTGTTTGAGGGAGGGTTA pLKO.1 581 CDS 100% 4.050 2.835 N Dnmt3l n/a
8 TRCN0000039105 CTTCTGGATATTCATGGACAA pLKO.1 1231 CDS 100% 4.050 2.835 N Dnmt3l n/a
9 TRCN0000039106 GAAGAGTATCTGCAAGCCCAA pLKO.1 1415 CDS 100% 2.160 1.512 N Dnmt3l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.