Transcript: Mouse NM_001081984.2

Mus musculus popeye domain containing 2 (Popdc2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Popdc2 (64082)
Length:
2203
CDS:
468..1583

Additional Resources:

NCBI RefSeq record:
NM_001081984.2
NBCI Gene record:
Popdc2 (64082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124418 GACAAGCTGTTTGCCAAGTTT pLKO.1 1215 CDS 100% 5.625 3.938 N Popdc2 n/a
2 TRCN0000124414 GATGGACATGACGTGAAGAAA pLKO.1 1829 3UTR 100% 5.625 3.938 N Popdc2 n/a
3 TRCN0000124417 GCACTACATCTTTCCGTATCA pLKO.1 989 CDS 100% 4.950 3.465 N Popdc2 n/a
4 TRCN0000124416 CTTCTCAAGTTATGTCCAGAT pLKO.1 1651 3UTR 100% 4.050 2.835 N Popdc2 n/a
5 TRCN0000124415 CTGCACTACATCTTTCCGTAT pLKO.1 987 CDS 100% 4.050 2.430 N Popdc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.