Transcript: Mouse NM_001082545.1

Mus musculus stefin A2 (Stfa2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Stfa2 (20862)
Length:
423
CDS:
31..342

Additional Resources:

NCBI RefSeq record:
NM_001082545.1
NBCI Gene record:
Stfa2 (20862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001082545.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092209 CACATCAGAAATCCAGGAGAT pLKO.1 84 CDS 100% 4.050 2.430 N Stfa2 n/a
2 TRCN0000092352 CGTCCAAGGACTAAATTACTT pLKO.1 189 CDS 100% 5.625 2.813 Y Stfa2l1 n/a
3 TRCN0000092211 AGACCACTGCTTGAAGAGAAA pLKO.1 118 CDS 100% 4.950 2.475 Y Stfa2 n/a
4 TRCN0000092349 CCAAGGACTAAATTACTTCAT pLKO.1 192 CDS 100% 4.950 2.475 Y Stfa2l1 n/a
5 TRCN0000092208 GCCATCGAGTATAAAGTTCAA pLKO.1 166 CDS 100% 4.950 2.475 Y Stfa2 n/a
6 TRCN0000262724 AGATTGCTGACAAGGTCAGAC pLKO_005 101 CDS 100% 4.050 2.025 Y BC100530 n/a
7 TRCN0000092210 GTTCAAGTCGTCCAAGGACTA pLKO.1 181 CDS 100% 4.050 2.025 Y Stfa2 n/a
8 TRCN0000092212 CGAGTATAAAGTTCAAGTCGT pLKO.1 171 CDS 100% 2.640 1.320 Y Stfa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001082545.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.