Transcript: Mouse NM_001083319.1

Mus musculus upstream binding protein 1 (Ubp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ubp1 (22221)
Length:
3857
CDS:
412..2034

Additional Resources:

NCBI RefSeq record:
NM_001083319.1
NBCI Gene record:
Ubp1 (22221)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001083319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086552 CGATGGAATTCGGCTCTATAA pLKO.1 1647 CDS 100% 0.000 0.000 N Ubp1 n/a
2 TRCN0000301999 CGATGGAATTCGGCTCTATAA pLKO_005 1647 CDS 100% 0.000 0.000 N Ubp1 n/a
3 TRCN0000086548 CGGACTGAACTCTATCCAGTA pLKO.1 2044 3UTR 100% 4.050 3.240 N Ubp1 n/a
4 TRCN0000302000 CGGACTGAACTCTATCCAGTA pLKO_005 2044 3UTR 100% 4.050 3.240 N Ubp1 n/a
5 TRCN0000086551 CCCACTGGTATCCACATTCTT pLKO.1 1912 CDS 100% 5.625 3.938 N Ubp1 n/a
6 TRCN0000331529 CCCACTGGTATCCACATTCTT pLKO_005 1912 CDS 100% 5.625 3.938 N Ubp1 n/a
7 TRCN0000086549 CGACTTATTAAAGCTGACAAA pLKO.1 1596 CDS 100% 4.950 3.465 N Ubp1 n/a
8 TRCN0000086550 GCCCTCCGTTTATCATGCAAT pLKO.1 1794 CDS 100% 4.950 3.465 N Ubp1 n/a
9 TRCN0000302001 GCCCTCCGTTTATCATGCAAT pLKO_005 1794 CDS 100% 4.950 3.465 N Ubp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.