Transcript: Mouse NM_001083587.1

Mus musculus tensin 3 (Tns3), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Tns3 (319939)
Length:
7483
CDS:
319..4641

Additional Resources:

NCBI RefSeq record:
NM_001083587.1
NBCI Gene record:
Tns3 (319939)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001083587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216938 CCTATGGGCAAAGTAACTATT pLKO.1 2051 CDS 100% 13.200 18.480 N Tns3 n/a
2 TRCN0000217821 CCTTCTCATTAACGGTCTTAT pLKO.1 7216 3UTR 100% 13.200 18.480 N Tns3 n/a
3 TRCN0000186310 CCCAAATGATAAACTCGTGAT pLKO.1 3765 CDS 100% 4.050 5.670 N Tns3 n/a
4 TRCN0000216749 GAGACAACTACCTGGTATTAA pLKO.1 455 CDS 100% 15.000 10.500 N Tns3 n/a
5 TRCN0000186969 CCACAAAGACATGACTGATAT pLKO.1 1638 CDS 100% 13.200 9.240 N Tns3 n/a
6 TRCN0000185365 GAAGAGATATGACCTTACAAA pLKO.1 486 CDS 100% 5.625 3.938 N Tns3 n/a
7 TRCN0000204010 GCTGGAGATTTGTCCAATGAA pLKO.1 3979 CDS 100% 5.625 3.938 N Tns3 n/a
8 TRCN0000189220 GCCAGGACTGATAAGACAGAA pLKO.1 1516 CDS 100% 4.950 3.465 N Tns3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.