Transcript: Human NM_001083588.2

Homo sapiens E2F transcription factor 5 (E2F5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
E2F5 (1875)
Length:
1961
CDS:
268..1305

Additional Resources:

NCBI RefSeq record:
NM_001083588.2
NBCI Gene record:
E2F5 (1875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013813 GCCACTAAACTGCCTGTATTT pLKO.1 1679 3UTR 100% 13.200 18.480 N E2F5 n/a
2 TRCN0000420299 CTATTAGTGGAGATATCATTG pLKO_005 1154 CDS 100% 10.800 15.120 N E2F5 n/a
3 TRCN0000013815 CCTATCCATGTGCTGCTTATA pLKO.1 934 CDS 100% 13.200 9.240 N E2F5 n/a
4 TRCN0000013817 GCAGACATCAGCTACAGATAT pLKO.1 1122 CDS 100% 13.200 9.240 N E2F5 n/a
5 TRCN0000231156 TGTAGGTGCTGGCTGTAATAC pLKO_005 615 CDS 100% 13.200 9.240 N E2f5 n/a
6 TRCN0000013814 CCGGCAGATGACTACAACTTT pLKO.1 1225 CDS 100% 5.625 3.938 N E2F5 n/a
7 TRCN0000013816 GCTGGCTGTAATACTAAAGAA pLKO.1 622 CDS 100% 5.625 3.938 N E2F5 n/a
8 TRCN0000422648 GAAATACCAGATCAATCTAAA pLKO_005 900 CDS 100% 13.200 7.920 N E2F5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.