Transcript: Human NM_001083621.1

Homo sapiens zinc finger and BTB domain containing 40 (ZBTB40), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Homo sapiens (human)
Gene:
ZBTB40 (9923)
Length:
8992
CDS:
512..4231

Additional Resources:

NCBI RefSeq record:
NM_001083621.1
NBCI Gene record:
ZBTB40 (9923)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235755 ACGTGGAAGGTGAGTAATAAA pLKO_005 2546 CDS 100% 15.000 21.000 N ZBTB40 n/a
2 TRCN0000235757 ACCCACCACCCTGACGTATTT pLKO_005 3590 CDS 100% 13.200 18.480 N ZBTB40 n/a
3 TRCN0000013536 GCAGACAGTCTACAGATGTTT pLKO.1 800 CDS 100% 5.625 7.875 N ZBTB40 n/a
4 TRCN0000013535 CCATTTCTACTGCCGCCTAAA pLKO.1 2746 CDS 100% 10.800 8.640 N ZBTB40 n/a
5 TRCN0000013534 GCAAACCTTTAGTGAGGCAAA pLKO.1 1168 CDS 100% 4.050 3.240 N ZBTB40 n/a
6 TRCN0000244324 ATAATTGCTGAGGGCTTATAG pLKO_005 6229 3UTR 100% 13.200 9.240 N ZBTB40 n/a
7 TRCN0000235758 GTTGAGGCTGTACCAATATTC pLKO_005 1447 CDS 100% 13.200 9.240 N ZBTB40 n/a
8 TRCN0000013533 CCTTTAATCAAAGGCTGAAAT pLKO.1 5036 3UTR 100% 1.320 0.924 N ZBTB40 n/a
9 TRCN0000235756 ACACAGCTGAGACCTATTATG pLKO_005 1607 CDS 100% 13.200 7.920 N ZBTB40 n/a
10 TRCN0000013537 GCTTGTACTGTGCTGCTACTT pLKO.1 3828 CDS 100% 4.950 2.970 N ZBTB40 n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 6625 3UTR 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 6625 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.