Transcript: Mouse NM_001083808.1

Mus musculus RUN and SH3 domain containing 1 (Rusc1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rusc1 (72296)
Length:
1928
CDS:
112..1407

Additional Resources:

NCBI RefSeq record:
NM_001083808.1
NBCI Gene record:
Rusc1 (72296)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001083808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247963 GCCTACTGTCCCTCTTGTATC pLKO_005 566 CDS 100% 10.800 15.120 N Rusc1 n/a
2 TRCN0000248488 ATCTGCAAGTCAGTATCTATG pLKO_005 1658 3UTR 100% 10.800 8.640 N Rusc1 n/a
3 TRCN0000247966 TTGGTTCAGAAGGCTCAATTG pLKO_005 226 CDS 100% 10.800 8.640 N Rusc1 n/a
4 TRCN0000247965 GGGAATTGCTTCGAGTCATTG pLKO_005 1301 CDS 100% 10.800 7.560 N Rusc1 n/a
5 TRCN0000166827 CAGGAGCAGAAGAAAGGTCTT pLKO.1 145 CDS 100% 4.050 2.835 N RUSC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.