Transcript: Mouse NM_001085390.1

Mus musculus dual specificity phosphatase 5 (Dusp5), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Dusp5 (240672)
Length:
1155
CDS:
1..1155

Additional Resources:

NCBI RefSeq record:
NM_001085390.1
NBCI Gene record:
Dusp5 (240672)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080891 TCCACGTTTATAGGCCATTTA pLKO.1 1006 CDS 100% 13.200 18.480 N Dusp5 n/a
2 TRCN0000080889 GCTGACATTAGCTCCCACTTT pLKO.1 706 CDS 100% 4.950 6.930 N Dusp5 n/a
3 TRCN0000080890 GAGACCTTCTACTCACAGTAT pLKO.1 388 CDS 100% 4.950 3.465 N Dusp5 n/a
4 TRCN0000080892 CCCGGTTGAAATCCTTCCCTT pLKO.1 534 CDS 100% 2.640 1.848 N Dusp5 n/a
5 TRCN0000368962 TGAAGGAGGCCTTCGATTACA pLKO_005 857 CDS 100% 5.625 3.938 N DUSP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.