Transcript: Mouse NM_001085407.1

Mus musculus serologically defined colon cancer antigen 3 (Sdccag3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sdccag3 (68112)
Length:
2045
CDS:
99..1247

Additional Resources:

NCBI RefSeq record:
NM_001085407.1
NBCI Gene record:
Sdccag3 (68112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142008 GATGACCAAACGGGCTGTAAA pLKO.1 941 CDS 100% 13.200 18.480 N ENTR1 n/a
2 TRCN0000249210 GATGACCAAACGGGCTGTAAA pLKO_005 941 CDS 100% 13.200 18.480 N Sdccag3 n/a
3 TRCN0000249211 CACGACCACCAGCCGAATTTA pLKO_005 326 CDS 100% 15.000 12.000 N Sdccag3 n/a
4 TRCN0000249208 TCGATAGACTCACTGATTTAC pLKO_005 1432 3UTR 100% 13.200 10.560 N Sdccag3 n/a
5 TRCN0000249209 CGGACGCTGCAGATAAGTTAT pLKO_005 735 CDS 100% 13.200 9.240 N Sdccag3 n/a
6 TRCN0000249207 GCTGAAATCCTCAAGTCTATC pLKO_005 1188 CDS 100% 10.800 7.560 N Sdccag3 n/a
7 TRCN0000190391 CCTTGAAGAAGCCAATCCATT pLKO.1 254 CDS 100% 4.950 3.465 N Sdccag3 n/a
8 TRCN0000191991 GATAAGTTATGAAGCACTGAA pLKO.1 746 CDS 100% 4.950 3.465 N Sdccag3 n/a
9 TRCN0000189560 CTCTCAAACTTGAGGCGAGAA pLKO.1 1017 CDS 100% 4.050 2.835 N Sdccag3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.