Transcript: Mouse NM_001085412.2

Mus musculus predicted gene 13078 (Gm13078), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm13078 (277666)
Length:
2110
CDS:
86..1510

Additional Resources:

NCBI RefSeq record:
NM_001085412.2
NBCI Gene record:
Gm13078 (277666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270091 CCTTGGTGTGGGCCAAATGAA pLKO_005 760 CDS 100% 5.625 4.500 N Gm13078 n/a
2 TRCN0000284187 CCTATGACCCACTGGATGTTC pLKO_005 660 CDS 100% 4.950 3.465 N Gm13078 n/a
3 TRCN0000270092 CATTACTAGGTTCTAACAAAT pLKO_005 1519 3UTR 100% 13.200 7.920 N Gm13078 n/a
4 TRCN0000270095 AGAGAAGGAAGCCCGTATTGT pLKO_005 841 CDS 100% 5.625 3.375 N Gm13078 n/a
5 TRCN0000270240 GAACCTACAAGTGCTTGATTT pLKO_005 379 CDS 100% 13.200 6.600 Y Pramef6 n/a
6 TRCN0000284186 GTGTTTATATTGTCGGAATTT pLKO_005 1459 CDS 100% 13.200 6.600 Y Gm13078 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.