Transcript: Mouse NM_001085414.2

Mus musculus PRAME family member 6 (Pramef6), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Pramef6 (195555)
Length:
1487
CDS:
78..1487

Additional Resources:

NCBI RefSeq record:
NM_001085414.2
NBCI Gene record:
Pramef6 (195555)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270197 GAAACAGACCGTGACTATAAA pLKO_005 506 CDS 100% 15.000 9.000 N Pramef6 n/a
2 TRCN0000346807 CAATCCAGGAATTGGCGATAA pLKO_005 694 CDS 100% 10.800 6.480 N Pramef6 n/a
3 TRCN0000270242 AGAGAAGGAAGCCCTTATTCT pLKO_005 833 CDS 100% 5.625 3.375 N Pramef6 n/a
4 TRCN0000270243 CATTAGAGACCCTTGCTATTA pLKO_005 967 CDS 100% 13.200 6.600 Y Pramef6 n/a
5 TRCN0000270240 GAACCTACAAGTGCTTGATTT pLKO_005 371 CDS 100% 13.200 6.600 Y Pramef6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.