Transcript: Mouse NM_001085518.1

Mus musculus predicted gene 14085 (Gm14085), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm14085 (381417)
Length:
3740
CDS:
1167..3149

Additional Resources:

NCBI RefSeq record:
NM_001085518.1
NBCI Gene record:
Gm14085 (381417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262711 GCTGAAATCATTACAACATTT pLKO_005 2745 CDS 100% 13.200 6.600 Y Gm14085 n/a
2 TRCN0000282398 TCCGGTTACCAGACATGAAAT pLKO_005 3326 3UTR 100% 13.200 6.600 Y Gm14085 n/a
3 TRCN0000262710 TTCAGTCTCTGCCAATCATTA pLKO_005 1948 CDS 100% 13.200 6.600 Y Gm14085 n/a
4 TRCN0000282401 TTCGGATGTGTGATGTCTATT pLKO_005 1974 CDS 100% 13.200 6.600 Y Gm14085 n/a
5 TRCN0000262709 GAGTAGAAGAGTGGATCAATG pLKO_005 2698 CDS 100% 10.800 5.400 Y Gm14085 n/a
6 TRCN0000079327 TGCTGGTTTATTCAGAAAGAT pLKO.1 1391 CDS 100% 5.625 2.813 Y Slc28a2 n/a
7 TRCN0000079326 CCTGCTTGGTCTCTTGTGTTT pLKO.1 1412 CDS 100% 4.950 2.475 Y Slc28a2 n/a
8 TRCN0000079323 CGCTCCAAGACAGTTCTCATA pLKO.1 3161 3UTR 100% 4.950 2.475 Y Slc28a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.