Transcript: Mouse NM_001085549.1

Mus musculus TraB domain containing 2B (Trabd2b), mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Trabd2b (666048)
Length:
6617
CDS:
95..1648

Additional Resources:

NCBI RefSeq record:
NM_001085549.1
NBCI Gene record:
Trabd2b (666048)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272019 ACTCACAACGTTCACCTTATA pLKO_005 4737 3UTR 100% 13.200 10.560 N Trabd2b n/a
2 TRCN0000271971 CCAGACTTGTGGTAGTAATAA pLKO_005 4966 3UTR 100% 15.000 10.500 N Trabd2b n/a
3 TRCN0000271973 CCTGTGGCCTAGCAGATTAAG pLKO_005 4629 3UTR 100% 13.200 9.240 N Trabd2b n/a
4 TRCN0000272020 GTACATGACCAGACCCTATAT pLKO_005 4121 3UTR 100% 13.200 9.240 N Trabd2b n/a
5 TRCN0000271972 TGTATGGCTAGGCCACTTAAA pLKO_005 4443 3UTR 100% 13.200 9.240 N Trabd2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.