Transcript: Human NM_001098.3

Homo sapiens aconitase 2 (ACO2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ACO2 (50)
Length:
2734
CDS:
31..2373

Additional Resources:

NCBI RefSeq record:
NM_001098.3
NBCI Gene record:
ACO2 (50)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344716 CCAACGAGTACATCCATTATG pLKO_005 146 CDS 100% 13.200 18.480 N ACO2 n/a
2 TRCN0000056558 CCCAACGAGTACATCCATTAT pLKO.1 145 CDS 100% 13.200 18.480 N ACO2 n/a
3 TRCN0000344719 GACATCCGAGTGGGTCTAATT pLKO_005 1156 CDS 100% 13.200 18.480 N ACO2 n/a
4 TRCN0000353090 ACAGGTGCAATCGTGGAATAC pLKO_005 811 CDS 100% 10.800 15.120 N ACO2 n/a
5 TRCN0000056560 GCCCGCTACTACAAGAAACAT pLKO.1 1969 CDS 100% 5.625 7.875 N ACO2 n/a
6 TRCN0000344661 GAATCATTCACCAGATTATTC pLKO_005 542 CDS 100% 13.200 9.240 N ACO2 n/a
7 TRCN0000056561 CCGGCTGACTACAACAAGATT pLKO.1 2164 CDS 100% 5.625 3.938 N ACO2 n/a
8 TRCN0000056559 GCTGCCATTATGACCAACTAA pLKO.1 1022 CDS 100% 5.625 3.938 N ACO2 n/a
9 TRCN0000056562 CCTGCTAGAGAAGAACATTAA pLKO.1 168 CDS 100% 13.200 7.920 N ACO2 n/a
10 TRCN0000333249 CCTGCTAGAGAAGAACATTAA pLKO_005 168 CDS 100% 13.200 7.920 N ACO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.