Transcript: Mouse NM_001098269.2

Mus musculus predicted gene 10375 (Gm10375), mRNA.

Source:
NCBI, updated 2017-05-02
Taxon:
Mus musculus (mouse)
Gene:
Gm10375 (100042342)
Length:
836
CDS:
9..518

Additional Resources:

NCBI RefSeq record:
NM_001098269.2
NBCI Gene record:
Gm10375 (100042342)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001098269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297030 AGAAATCTCCAGAACATTAAA pLKO_005 105 CDS 100% 15.000 9.000 N Gm10375 n/a
2 TRCN0000272131 AGAAGATCAAAGACGAATATA pLKO_005 463 CDS 100% 15.000 7.500 Y Gm10375 n/a
3 TRCN0000177557 CAGAAGATCAAAGACGAATAT pLKO.1 462 CDS 100% 13.200 6.600 Y 1700001F09Rik n/a
4 TRCN0000297089 CATTGGAAGAATGCAACATAA pLKO_005 412 CDS 100% 13.200 6.600 Y Gm10375 n/a
5 TRCN0000297090 GAGGAGGCTGTTATGTCAAAT pLKO_005 520 3UTR 100% 13.200 6.600 Y Gm10375 n/a
6 TRCN0000177829 CCAGAAGATCAAAGACGAATA pLKO.1 461 CDS 100% 10.800 5.400 Y 1700001F09Rik n/a
7 TRCN0000297088 TGAATGACAGGACCAACTTTG pLKO_005 172 CDS 100% 10.800 5.400 Y Gm10375 n/a
8 TRCN0000192057 CCACCTCCTGATTGAATCTAA pLKO.1 326 CDS 100% 5.625 2.813 Y BC061237 n/a
9 TRCN0000178530 GCCAAGTACAAGGATTTGAAT pLKO.1 156 CDS 100% 5.625 2.813 Y 1700001F09Rik n/a
10 TRCN0000178165 GCCAGCATTTGACTAAAGAAA pLKO.1 280 CDS 100% 5.625 2.813 Y 1700001F09Rik n/a
11 TRCN0000182841 CCTTCTCTGCACTTGGTGAAT pLKO.1 584 3UTR 100% 4.950 2.475 Y Gm5800 n/a
12 TRCN0000200054 CCAGATGATGACTGACCTGAA pLKO.1 221 CDS 100% 4.050 2.025 Y 1700001F09Rik n/a
13 TRCN0000198122 CCTGATTGAATCTAACCTCAT pLKO.1 332 CDS 100% 4.050 2.025 Y 1700001F09Rik n/a
14 TRCN0000182446 GAAGAGCAACAACAGGACCAA pLKO.1 620 3UTR 100% 2.640 1.320 Y 1700001F09Rik n/a
15 TRCN0000178361 GCATTGGAAGAATGCAACATA pLKO.1 411 CDS 100% 0.563 0.281 Y 1700001F09Rik n/a
16 TRCN0000198248 GATTGCATTGGAAGAATGCAA pLKO.1 407 CDS 100% 0.300 0.150 Y 1700001F09Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.