Transcript: Human NM_001099666.2

Homo sapiens protein prenyltransferase alpha subunit repeat containing 1 (PTAR1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
PTAR1 (375743)
Length:
10099
CDS:
74..1282

Additional Resources:

NCBI RefSeq record:
NM_001099666.2
NBCI Gene record:
PTAR1 (375743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001099666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446174 GGTGTCATAGGCGGCATATTT pLKO_005 1011 CDS 100% 15.000 21.000 N PTAR1 n/a
2 TRCN0000437992 GGGTGCTACAACAGCTAATTC pLKO_005 507 CDS 100% 13.200 18.480 N PTAR1 n/a
3 TRCN0000436494 GACTCCCTAGGCCTAGAAATG pLKO_005 1160 CDS 100% 10.800 15.120 N PTAR1 n/a
4 TRCN0000036385 CGCCTTAACCAAGTTTCCAAA pLKO.1 457 CDS 100% 4.950 6.930 N PTAR1 n/a
5 TRCN0000036386 GCGACTCATACAAGAAGAGAT pLKO.1 595 CDS 100% 4.950 6.930 N PTAR1 n/a
6 TRCN0000416553 AGATACCCAAGCAACTATAAT pLKO_005 641 CDS 100% 15.000 10.500 N PTAR1 n/a
7 TRCN0000431950 ATGTCCTGAAGCTAGGTATAA pLKO_005 181 CDS 100% 13.200 9.240 N PTAR1 n/a
8 TRCN0000434407 GATGAACTATCTTCTACTAAA pLKO_005 725 CDS 100% 13.200 9.240 N PTAR1 n/a
9 TRCN0000367088 TCTACCTTCAGCATCACTTAA pLKO_005 1032 CDS 100% 13.200 9.240 N Ptar1 n/a
10 TRCN0000421157 ACTCTAGCAAGCAAGGCTATT pLKO_005 1101 CDS 100% 10.800 7.560 N PTAR1 n/a
11 TRCN0000429466 CCAATTGCTGCATAGGCAAAT pLKO_005 1611 3UTR 100% 10.800 7.560 N PTAR1 n/a
12 TRCN0000414937 TCTGGCACTTTAAATCCAATT pLKO_005 413 CDS 100% 10.800 7.560 N PTAR1 n/a
13 TRCN0000036388 CATAGATGAAATTGGCCTGAT pLKO.1 157 CDS 100% 4.050 2.835 N PTAR1 n/a
14 TRCN0000036387 GCATACAGGAAATGGCTGGTT pLKO.1 1247 CDS 100% 2.640 1.848 N PTAR1 n/a
15 TRCN0000036384 GCCAAGCTAGATGTCAAGATT pLKO.1 698 CDS 100% 5.625 3.375 N PTAR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.