Transcript: Human NM_001100388.1

Homo sapiens chromosome 11 open reading frame 88 (C11orf88), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
C11orf88 (399949)
Length:
719
CDS:
1..510

Additional Resources:

NCBI RefSeq record:
NM_001100388.1
NBCI Gene record:
C11orf88 (399949)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001100388.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134527 GAAGAAAGGATCTCGAAAGAA pLKO.1 385 CDS 100% 5.625 3.938 N C11orf88 n/a
2 TRCN0000136752 GAACTGATTTCCCTTCCGTAT pLKO.1 403 CDS 100% 4.050 2.835 N C11orf88 n/a
3 TRCN0000137435 GATACAGGAATCTGAGGAGAA pLKO.1 300 CDS 100% 4.050 2.835 N C11orf88 n/a
4 TRCN0000134333 GAAGAGATTCTCCAACTCTTA pLKO.1 352 CDS 100% 0.495 0.347 N C11orf88 n/a
5 TRCN0000136962 CAGGAATCTGAGGAGAAAGTA pLKO.1 304 CDS 100% 5.625 3.375 N C11orf88 n/a
6 TRCN0000134831 CCTAAAGATACAGGAATCTGA pLKO.1 294 CDS 100% 3.000 1.800 N C11orf88 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100388.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.