Transcript: Human NM_001100419.1

Homo sapiens required for excision 1-B domain containing (REX1BD), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
REX1BD (55049)
Length:
834
CDS:
118..657

Additional Resources:

NCBI RefSeq record:
NM_001100419.1
NBCI Gene record:
REX1BD (55049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001100419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263874 CCTTAGGTTTGATGCGGAATC pLKO_005 627 CDS 100% 6.000 8.400 N REX1BD n/a
2 TRCN0000282843 ATGCGGAATCTGCCGAGTGAT pLKO_005 638 CDS 100% 4.950 6.930 N REX1BD n/a
3 TRCN0000281602 ATGGAGGCGATCAGCGAGGTT pLKO_005 598 CDS 100% 0.880 0.704 N REX1BD n/a
4 TRCN0000263872 GTACGGATGCAGCAGCTGAAA pLKO_005 559 CDS 100% 4.950 3.465 N REX1BD n/a
5 TRCN0000263873 AGGTTCTCCAGGACCTTAGGT pLKO_005 614 CDS 100% 3.000 2.100 N REX1BD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.