Transcript: Human NM_001100631.2

Homo sapiens PRAME family member 22 (PRAMEF22), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
PRAMEF22 (653606)
Length:
1446
CDS:
7..1446

Additional Resources:

NCBI RefSeq record:
NM_001100631.2
NBCI Gene record:
PRAMEF22 (653606)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001100631.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282217 TGTACTAAGGTGGTGAATTAT pLKO_005 550 CDS 100% 15.000 7.500 Y PRAMEF22 n/a
2 TRCN0000142846 CGTTGGAGACATTGGCATTAA pLKO.1 887 CDS 100% 13.200 6.600 Y PRAMEF18 n/a
3 TRCN0000136068 GCGGGATGTTGATGAGAATTT pLKO.1 321 CDS 100% 13.200 6.600 Y PRAMEF2 n/a
4 TRCN0000256860 CCGTTGGAGACATTGGCATTA pLKO_005 886 CDS 100% 10.800 5.400 Y PRAMEF19 n/a
5 TRCN0000262391 CGCCTGATCTGGAGATCTTAC pLKO_005 221 CDS 100% 10.800 5.400 Y PRAMEF22 n/a
6 TRCN0000267626 TGTAGTGGATGGGATTGATTG pLKO_005 246 CDS 100% 10.800 5.400 Y PRAMEF19 n/a
7 TRCN0000130446 GACAGCCAAGAACAGTTAGTT pLKO.1 754 CDS 100% 5.625 2.813 Y PRAMEF3 n/a
8 TRCN0000130346 GAGGAATCTTCGCAAACTCTT pLKO.1 699 CDS 100% 4.950 2.475 Y PRAMEF3 n/a
9 TRCN0000129627 CAAGAACAGTTAGTTGCTGAA pLKO.1 760 CDS 100% 4.050 2.025 Y PRAMEF3 n/a
10 TRCN0000144536 CATTATGTAGTGGATGGGATT pLKO.1 241 CDS 100% 4.050 2.025 Y PRAMEF18 n/a
11 TRCN0000122569 CCCTTGAAGGTGTTCATGGAT pLKO.1 442 CDS 100% 3.000 1.500 Y PRAMEF18 n/a
12 TRCN0000128569 GCATTAACTTATGGCTTCCTA pLKO.1 901 CDS 100% 3.000 1.500 Y PRAMEF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100631.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.